MultiMPrimer3 Input Help (based on Primer3 Input release 0.4.0) (2024)

The sequence from which to select primers or hybridizationoligos.

An identifier that is reproduced in the output to enable you toidentify the chosen primers.

If one or more Targets is specified then a legal primer pair mustflank at least one of them. A Target might be a simple sequencerepeat site (for example a CA repeat) or a single-base-pairpolymorphism. The value should be a space-separated list of

start,length

pairs where start is the index of the first base of aTarget, and length is its length.

Excluded Regions

Primer oligos may not overlap any region specified in this tag.The associated value must be a space-separated list of

start,length

pairs where start is the index of the first base ofthe excluded region, and length is its length. This tag isuseful for tasks such as excluding regions of low sequencequality or for excluding regions containing repetitive elementssuch as ALUs or LINEs.

Product Size Range

A list of product size ranges, for example

150-250 100-300 301-400

Primer3 first tries to pickprimers in the first range. If that is not possible,it goes to the next range and tries again. It continues in thisway until it has either picked all necessary primers or until there are nomore ranges. For technical reasons this option makes much lightercomputational demands than the Product Size option.

Product Size

Minimum, Optimum, and Maximum lengths (in bases) of the PCR product.Primer3 will not generate primers with products shorter than Minor longer than Max, and with default arguments Primer3 willattempt to pick primers producing products close to the Optimumlength.

Number To Return

The maximum number of primer pairs to return. Primer pairsreturned are sorted by their "quality", in other words by thevalue of the objective function (where a lower number indicates abetter primer pair). Caution: setting this parameter to a largevalue will increase running time.

Max 3' Stability

The maximum stability for the last five 3' bases of a left or rightprimer. Bigger numbers mean more stable 3' ends. The value isthe maximum delta G (kcal/mol) for duplex disruption for the five 3' basesas calculated using the Nearest-Neighbor parameter values specified bythe option of 'Table of thermodynamicparameters'. For example if the table of thermodynamic parameters suggestedby SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 is used the deltaG values for the most stable and for the most labile 5mer duplex are 6.86 kcal/mol (GCGCG) and 0.86 kcal/mol (TATAT) respectively.If the table of thermodynamic parameters suggested by Breslauer et al. 1986, 10.1073/pnas.83.11.3746 is used the deltaG values for the most stable and for the most labile 5mer are 13.4 kcal/mol (GCGCG) and 4.6 kcal/mol (TATAC) respectively.

Max Mispriming

The maximum allowed weighted similarity with any sequence inMispriming Library.Default is 12.

Max Template Mispriming

The maximum allowed similarity to ectopic sites in thesequence from which you are designing the primers. The similarity is basedon thermodynamic approach. A negative value means do not check. To considerthis argument you have to provide the maximum value of melting temperaturewhich could be achieved when primer hybridizes to alternative site of template.

Pair Max Mispriming

The maximum allowed sum of similarities of a primer pair(one similarity for each primer) with any single sequence inMispriming Library.Library sequence weights are not used in computing the sum of similarities.

Pair Max Template Mispriming

The maximum allowed summed similarity of both primers toectopic sites in the sequence from which you are designing the primers. The principle is the sameas Max Template Mispriming.

Primer Size

Minimum, Optimum, and Maximum lengths (in bases) of a primer oligo.Primer3 will not pick primers shorter than Min or longer thanMax, and with default arguments will attempt to pick primersclose with size close to Opt. Min cannot be smaller than 1.Max cannot be larger than 36.(This limit is governed by maximum oligo size for whichmelting-temperature calculations are valid.)Min cannot be greater than Max.

Primer T_m

Minimum, Optimum, and Maximum melting temperatures (Celsius)for a primer oligo. Primer3 will not pick oligos with temperaturessmaller than Min or larger than Max, and with default conditionswill try to pick primers with melting temperatures close to Opt.

By default Primer3 uses the oligo melting temperature formula and the tableof thermodynamic parameters given in Breslauer et al. 1986, DOI:10.1073/pnas.83.11.3746For more information see caption Table of thermodynamic parameters

Maximum T_m Difference

Maximum acceptable (unsigned) difference between the meltingtemperatures of the left and right primers.

Table of thermodynamic parameters

Option for the table of Nearest-Neighbor thermodynamic parameters and for the method ofmelting temperature calculation. Two different tables of thermodynamicparameters are available:

Breslauer et al. 1986, DOI:10.1073/pnas.83.11.3746 Inthat case the formula for melting temperature calculation suggested byRychlik et al. 1990 is used (this is used untilPrimer3 version 1.0.1). This is the default value of Primer3 (for backwardcompatibility).
SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 This is the recommended value.

For specifying the salt correction method for melting temperature calculation seeSalt correction formula

Product T_m

The minimum, optimum, and maximum melting temperature of theamplicon. Primer3 will not pick a product with meltingtemperature less than min or greater than max. If Opt is suppliedand the Penalty Weights for ProductSize are non-0 Primer3 will attempt to pick an amplicon withmelting temperature close to Opt.

The maximum allowed melting temperature of the amplicon. Primer3calculates product T_m calculated using the formula from Boltonand McCarthy, PNAS 84:1390 (1962) as presented in Sambrook,Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHLPress).

T_m = 81.5 + 16.6(log₁₀([Na+])) + .41*(%GC) - 600/length,

where [Na+] is the molar sodium concentration, (%GC) is thepercent of Gs and Cs in the sequence, and length is the length ofthe sequence.

A similar formula is used by the prime primer selection programin GCG (http://www.accelrys.com/products/gcg/),which instead uses 675.0 / length inthe last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E.Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766without the mismatch and formamide terms). The formulas here andin Baldino et al. assume Na+ rather than K+. According toJ.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227(1991) 50 mM K+ should be equivalent in these formulae to .2 MNa+. Primer3 uses the same salt concentration value forcalculating both the primer melting temperature and the oligomelting temperature. If you are planning to use the PCR productfor hybridization later this behavior will not give you the T_munder hybridization conditions.

Primer GC%Minimum, Optimum, and Maximum percentage of Gs and Cs in any primer oroligo.

Max Complementarity

The melting temperature of the most stable structure is calculated. To calculate secondary structures nearest-neighbor parameters for perfect matches, single internal mismatches, terminal mismatches, dangling ends have been used. Also parameters for increments for length dependence of bulge and internal loops have been used. The by default value is 10 degrees lower than the default value of primer minimum melting temperature. For example, the alignment width length 15nt

 5' ATTAGATAGAGCATC 3' 3' TAATCTATCTCGTAG 5'

is allowed (and yields a melting temperature of 32.1493width by defaultprimer3 parameters), but the alignment

 T C 5' GCGGCCGC GCGC 3' 3' CGCCGGCG CGCG 5' A A

is not considered (Tm=57.0997 and the length of oligo is 14nt).Thermodynamical parameters and methods for findingthe most stable structure are described in following papers:

[SantaLucia JR (1998) "A unified view of polymer, dumbbell andoligonucleotide DNA nearest-neighborthermodynamics", Proc Natl Acad Sci 95:1460-65http://dx.doi.org/10.1073/pnas.95.4.1460]
[SantaLucia JR and Hicks D (2004) "The thermodynamics of DNA structuralmotifs", Annu Rev Biophys Biomol Struct 33:415-40http://dx.doi.org/10.1146/annurev.biophys.32.110601.141800]
[Bommarito S, Peyret N and SantaLucia J Jr (2000) "Thermodynamic parametersfor DNA sequences with dangling ends", Nucleic Acids Res 28(9):1929-34http://dx.doi.org/10.1093/nar/28.9.1929]
[Peyret N, Seneviratne PA, Allawi HT, SantaLucia J Jr. (1999)"Nearest-neighbor thermodynamics and NMR of DNA sequences with internal A.A,C.C, G.G, and T.T mismatches", Biochemistry 38(12):3468-77http://dx.doi.org/10.1021/bi9825091]
[Allawi HT and SantaLucia J Jr. (1998) "Nearest-Neighbor Thermodynamics ofInternal A·C Mismatches in DNA: Sequence Dependence and pH Effects",Biochemistry 37(26):9435-44http://dx.doi.org/10.1021/bi9803729
[Allawi HT and SantaLucia J Jr. (1998) "Thermodynamics of internal C.Tmismatches in DNA." Nucleic Acids Res 26(11):2694-701http://dx.doi.org/10.1093/nar/26.11.2694]
[Allawi HT and SantaLucia J Jr. (1998) "Nearest neighbor thermodynamicparameters for internal G.A mismatches in DNA." Biochemistry 37(8):2170-9http://dx.doi.org/10.1021/bi9724873]
[Allawi HT and SantaLucia J Jr. (1997) "Thermodynamics and NMR of internalG.T mismatches in DNA." Biochemistry 36(34):10581-94http://dx.doi.org/10.1021/bi962590c]
[SantaLucia J Jr and Peyret N. (2001) "Method and system for predictingnucleic acid hybridization thermodynamics and computer-readable storagemedium for use therein" World Intellectual Property Organization, WO 01/94611http://www.wipo.int/pctdb/en/wo.jsp?wo=2001094611]

Predicting secondary structures can improve primer design by eliminatingsequences with high possibility to form alternative secondary structures.

Max 3' Complementarity

The maximum allowable 3'-anchored melting temperature whentesting a single primer for self-complementarity, and the maximumallowable 3'-anchored melting temperature when testing forcomplementarity between left and right primers. For example

5' ATGCCCTAGCTTCCGGATG 3' ||| ||||| 3' AAGTCCTACATTTAGCCTAGT 5'

5` AGGCTATGGGCCTCGCGA 3' |||||| 3' AGCGCTCCGGGTATCGGA 5'

The thermodynamic approach used is as for the Max Complementarity.

Primer hairpin stability

This is the most stable monomer structure of internal oligocalculated by thermodynamic approach. The hairpin loops,bulge loops, internal loops, internal single mismatches, dangling ends,terminal mismatches have been considered. The by default value is 10 degreeslower than the default value of primer minimum melting temperature. For example the structure:

 -///------\\\- 5' ACGCTGTGCTGCGA 3'

with melting temperature 53.7263 (calculated according to bydefault values of primer3) and

 //////----\\\\\\ 5' CCGCAGTAAGCTGCGG 3'

with melting temperature 71.0918 (calculated according to bydefault values of primer3)

Max Poly-X

The maximum allowable length of a mononucleotide repeat,for example AAAAAA.

Included Region

A sub-region of the given sequence in which to pick primers. Forexample, often the first dozen or so bases of a sequence arevector, and should be excluded from consideration. The value forthis parameter has the form

start,length

where start is the index of the first base to consider,and length is the number of subsequent bases in theprimer-picking region.

CG Clamp

Require the specified number of consecutive Gs and Cs at the 3'end of both the left and right primer. (This parameter has noeffect on the hybridization oligo if one is requested.)

Concentration of monovalent cations

The millimolar concentration of salt (usually KCl) in the PCR.Primer3 uses this argument to calculate oligo meltingtemperatures.

Concentration of divalentcations

The millimolar concentration of divalent salt cations (usuallyMgCl²⁺ in the PCR).Primer3 converts concentration of divalent cations to concentrationof monovalent cations using formula suggested in the paper Ahsen et al., 2001

 [Monovalent cations] = [Monovalent cations] + 120*(√([divalent cations] - [dNTP]))

According to the formula concentration of desoxynucleotide triphosphate[dNTP] must be smaller than concentration of divalent cations. Theconcentration of dNTPs is included to the formula beacause of some magnesiumis bound by the dNTP. Attained concentration of monovalent cations is usedto calculate oligo/primer melting temperature. See Concentration of dNTPs to specify the concentrationof dNTPs.

Concentration of dNTPs

The millimolar concentration of deoxyribonucleotide triphosphate. Thisargument is considered only if Concentrationof divalent cations is specified.

Salt correction formula

Option for specifying the salt correction formula for the melting temperaturecalculation.

Schildkraut and Lifson 1965, DOI:10.1002/bip.360030207(this is used until the version 1.0.1 of Primer3).The default value ofPrimer3 version 1.1.0 (for backward compatibility)
SantaLucia 1998, DOI:10.1073/pnas.95.4.1460 This is the recommended value.
Owczarzy et al. 2004, DOI:10.1021/bi034621r

Annealing Oligo Concentration

The nanomolar concentration of annealing oligos in the PCR.Primer3 uses this argument to calculate oligo meltingtemperatures. The default (50nM) works well with the standardprotocol used at the Whitehead/MIT Center for GenomeResearch--0.5 microliters of 20 micromolar concentration for eachprimer oligo in a 20 microliter reaction with 10 nanogramstemplate, 0.025 units/microliter Taq polymerase in 0.1 mM eachdNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35cycles with an annealing temperature of 56 degrees Celsius. Thisparameter corresponds to 'c' in Rychlik, Spencer and Rhoads'equation (ii) (Nucleic Acids Research, vol 18, num 21) where asuitable value (for a lower initial concentration of template) is"empirically determined". The value of this parameter is lessthan the actual concentration of oligos in the reaction becauseit is the concentration of annealing oligos, which in turndepends on the amount of template (including PCR product) in agiven cycle. This concentration increases a great deal during aPCR; fortunately PCR seems quite robust for a variety of oligomelting temperatures.

Length of alternativeproduct

The maximal length of alternative product (in bp) to be calculated.Alternativeproducts are looked from genomes of non-target species, including humangenome.

FASTA

Primer design for a sequence.Maximally "Number To Return" primer pairs will bereturned per one FASTA format file. Example input file may be found fromHERE.

Example of the sequence in FASTA format:
>Name of the sequenceACCGATGCACGACGATCGACACGATCGACATCATATATATTTTGCGCGCATCGCGGCGCGCGATATCGATCGACTGATCGATACGCGACGACCACGCACGCGGATATACGATCGACTCGACATCGACATCGATCGATAGCTAGCCTA

CLUSTALW

Primer design for a multiple alignment. Maximally "Number To Return"primer pairs will bereturned per one multiple alignment (or a file).

Example of the sequence in CLUSTALW format:

CLUSTAL W (1.83) multiple sequence alignmentL43967.390305.390804.500.1.+ AGAAAAAGTTGTTTGGTCTTGTTGATCTGTATCAATTGGTAATTGGTAACL43967.389393.389845.500.2.+ AGAAAAAGTTGTTTGGTCTTGTTGATCTGTATCAATTGGTAATTGGTAAC **************************************************L43967.390305.390804.500.1.+ TATCAACTACTTGGGCTTGTTTACTTTCAAAATCAGTAGTTACTTTTTTTL43967.389393.389845.500.2.+ TATCAACTACTTGGGCTTGTTTACTTTCAAAATCAGTAGTTACTTCTTTT ********************************************* ****

Max Ns Accepted

Maximum number of unknown bases (N) allowable in any primer.Max Ns Accepted to anon-0 value.Perhaps '-' and '* ' should be squeezed out rather than changedto 'N', but currently they simply get converted to N's. The authorsinvite user comments.MultiMPrimer3 is the modified version of widely usedprogram Primer3.

Copyright Notice and Disclaimer

Redistribution and use in source and binary forms, with or withoutmodification, are permitted provided that the following conditions aremet: * Redistributions of source code must retain the above copyrightnotice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the abovecopyright notice, this list of conditions and the following disclaimerin the documentation and/or other materials provided with thedistribution. * Neither the names of the copyright holders nor contributors maybe used to endorse or promote products derived from this softwarewithout specific prior written permission.THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOTLIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FORA PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHTOWNERS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOTLIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANYTHEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USEOF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

Acknowledgments

The development of Primer3 and the Primer3web site was funded by Howard Hughes Medical Instituteand by the National Institutes of Health,National Human Genome Research Institute.under grants R01-HG00257(to David C. Page) and P50-HG00098 (to Eric S. Lander).

We thankCenterline Software, Inc.,for use of their TestCenter memory-error, -leak, and test-coverage checker.

Web interface bySteve Rozen.
Release 0.4.0
Last modified: February 07, 2007